The flavoprotein Mcap0476 (RlmFO) catalyzes m5U1939 modification in Mycoplasma capricolum 23S rRNA

نویسندگان

  • Carole Lartigue
  • Anne Lebaudy
  • Alain Blanchard
  • Basma El Yacoubi
  • Simon Rose
  • Henri Grosjean
  • Stephen Douthwaite
چکیده

Efficient protein synthesis in all organisms requires the post-transcriptional methylation of specific ribosomal ribonucleic acid (rRNA) and transfer RNA (tRNA) nucleotides. The methylation reactions are almost invariably catalyzed by enzymes that use S-adenosylmethionine (AdoMet) as the methyl group donor. One noteworthy exception is seen in some bacteria, where the conserved tRNA methylation at m5U54 is added by the enzyme TrmFO using flavin adenine dinucleotide together with N5,N10-methylenetetrahydrofolate as the one-carbon donor. The minimalist bacterium Mycoplasma capricolum possesses two homologs of trmFO, but surprisingly lacks the m5U54 tRNA modification. We created single and dual deletions of the trmFO homologs using a novel synthetic biology approach. Subsequent analysis of the M. capricolum RNAs by mass spectrometry shows that the TrmFO homolog encoded by Mcap0476 specifically modifies m5U1939 in 23S rRNA, a conserved methylation catalyzed by AdoMet-dependent enzymes in all other characterized bacteria. The Mcap0476 methyltransferase (renamed RlmFO) represents the first folate-dependent flavoprotein seen to modify ribosomal RNA.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

The ribosomal genes of Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the ge...

متن کامل

Molecular evolution of Mycoplasma capricolum subsp. capripneumoniae strains, based on polymorphisms in the 16S rRNA genes.

Mycoplasma capricolum subsp. capripneumoniae belongs to the so-called Mycoplasma mycoides cluster and is the causal agent of contagious caprine pleuropneumonia (CCPP). All members of the M. mycoides cluster have two rRNA operons. The sequences of the 16S rRNA genes of both rRNA operons from 20 strains of M. capricolum subsp. capripneumoniae of different geographical origins in Africa and Asia w...

متن کامل

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

متن کامل

Promoters of Mycoplasma capricolum ribosomal RNA operons: identical activities but different regulation in homologous and heterologous cells

The 5' region of the rRNA operon, rrnA, of M. capricolum was cloned. Sequence analysis revealed two tRNA genes, tRNA(leu) and tRNA(lys), upstream to the promoter of the rRNA operon. The in vivo transcription start sites of the rRNA operon and of the tRNA genes were mapped. The same promoters used by M. capricolum RNA polymerase are also recognized by E. coli RNA polymerase both in vivo and in v...

متن کامل

Heterogeneity among Dermatophilus congolensis isolates demonstrated by restriction fragment length polymorphisms.

There is evidence of antigenic diversity and of differences in virulence in Dermatophilus congolensis. For the understanding of the epidemiology of dermatophilosis it is important to distinguish between strains of the organism. Twenty field isolates from cattle in Chad and Cameroon, and an American reference strain, have been examined on restriction fragment length polymorphisms. After restrict...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:

دوره 42  شماره 

صفحات  -

تاریخ انتشار 2014